View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_72 (Length: 341)
Name: NF9917A_low_72
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_72 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 5 - 261
Target Start/End: Original strand, 25027103 - 25027357
Alignment:
| Q |
5 |
tactccccaagaaattgtgggaccatttccatatcccacaagattgtagaatatttcacaatatactctattataaccatatattcattattagttttgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25027103 |
tactccccaagaaattgtgggaccatttccatatcccacaagattgtagaatatttcacaatatactctattataaccatatattcattattacttttgt |
25027202 |
T |
|
| Q |
105 |
catatgcataagtctaactgtcatataattactcatcacctatagggatcacatggttgaagtagcaacaagctgattcactctttgttttgttcaaaat |
204 |
Q |
| |
|
|| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25027203 |
cacatgcataagtctaactgtcatataggt-ctcatcacctatagggatcacatggttgaagtagcaacaagctgattcac-ctttgttttgttcaaaat |
25027300 |
T |
|
| Q |
205 |
gaatgagaagtgagaattcagaattcccaaaatgttcaaaactctcaatatgttggc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25027301 |
gaatgagaagtgagaattcagaattcccaaaatgttcaaaactctcaatatgttggc |
25027357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 253 - 341
Target Start/End: Original strand, 25031889 - 25031977
Alignment:
| Q |
253 |
tatgttggcatggttatcacattatcacttccctccaaaaatacgtactgattggttccagtcccatccctctctggtaaatctacctc |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031889 |
tatgttggcatggttatcacattatcacttccctccaaaaatacgtactgattggttccagtcccatccctctctggtaaatctacctc |
25031977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University