View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917_high_11 (Length: 310)
Name: NF9917_high_11
Description: NF9917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 34023822 - 34024086
Alignment:
| Q |
18 |
acatcttgtgtttgtatttt-aaagttcagtgcaaaattagcaaaattcactaaattgtttaatttttctttcacaaattgatgaactaaattgctttat |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34023822 |
acatcttgtgtttgtatttttaaagttcagtgcaaaattaggaaaattcactaaattgtttaatttttctttcacaaattgatgaactaaattgctttat |
34023921 |
T |
 |
| Q |
117 |
aatatcaaggttgcacaaaatggtattgttggctcactttcttacaaataatcacctcatgcttatacctttgcaattaattgatcgtgattgtttaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
34023922 |
aatatcaaggttgcacaaaatggtattgttggctcactttcttacaaataatcacctcatgcttatacctttgtaattaattgagcgtgattgtttaagg |
34024021 |
T |
 |
| Q |
217 |
accatagataaatagaattgttatttaagtattaaagtatctatatagcattgaatgtgtttatc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34024022 |
accatagataaatagaattgttatttaagtattaaagtatctatatagcattgtatgtgtttatc |
34024086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University