View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917_high_13 (Length: 272)
Name: NF9917_high_13
Description: NF9917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 97 - 262
Target Start/End: Complemental strand, 20371152 - 20370987
Alignment:
| Q |
97 |
aaagtgctcaacatttctccctcgttcttatttattttttctcactctttcaatgaaatttttctccctcaaccaaatgtttcctcagcccattcttttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20371152 |
aaagtgctcaacatttctccctcgttcttatttttttttcctcactctttcaatgaaatttttctccctcaaccaaatgtttcctcagtccattcttttt |
20371053 |
T |
 |
| Q |
197 |
ctgccctaactctttacctacaccaccaaacctatcgaagcatgtcacattagtccaacccctttg |
262 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20371052 |
cttccctaactctttacctacaccaccaaacctattgaagcatgtcacattagtccaacccctttg |
20370987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 36 - 79
Target Start/End: Complemental strand, 20371225 - 20371182
Alignment:
| Q |
36 |
agaattattcttaaccttctctagttatagccttcgtgcatgac |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20371225 |
agaattattcttaaccttctctagttatagccttcgtgcatgac |
20371182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University