View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917_low_24 (Length: 253)
Name: NF9917_low_24
Description: NF9917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917_low_24 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 11834088 - 11833854
Alignment:
| Q |
18 |
aatcaattgtaattgtaaagcatattttgcttactttatgatgtttagtattttgattcctaaataaaaacgattggcctttattaggttcttaannnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11834088 |
aatcaattgtaattgtaaagcatattttgcttactttatgatgtttagtattttgattcctaaataaaaacgattggcctttattaggttcttaattttt |
11833989 |
T |
 |
| Q |
118 |
nnnattgactttatttttcattactgcattgaatttgaaaatattatatacataaggaatcggtcttaaatttgaaatatctaggatctggatcctctcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11833988 |
tttattgactttatttttcattactgcattgaatttgaaaatattatatacataaggaatcggtcttaaatttgaaatat-taggatctggatcctctcc |
11833890 |
T |
 |
| Q |
218 |
tacgctactcgtccatgtaatcatctcttttgcgtt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11833889 |
tacgctactcgtccatgtaatcatctcttttgcgtt |
11833854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University