View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917_low_27 (Length: 247)
Name: NF9917_low_27
Description: NF9917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 32310113 - 32309891
Alignment:
| Q |
19 |
ggaggattgtcttagcttaataatctaccgaacacctaagattttcctctttgttgggaagattgtcttagcttactaatcgaccgcacattaaccaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32310113 |
ggaggattgtcttagcttaataatctaccgaacacctaagattttcctctttgttgggaagattgtcttagcttactgatcgaccgcacattaaccaaaa |
32310014 |
T |
|
| Q |
119 |
cagttgctaagttgcacaaaccacaactagtaaaattactgtatatcttat-----ttaaactgcatagttgaataaagcttaactagtaatctgaacaa |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
32310013 |
cagttgctaagttgcacaaaccacaactagtaaaattactgtatatcttatttaatttaaactgcctagttgaataaagcttaactagtaatctgaataa |
32309914 |
T |
|
| Q |
214 |
aattctttagcccttcctttgct |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32309913 |
aattctttagcccttcctttgct |
32309891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 104
Target Start/End: Complemental strand, 32310138 - 32310084
Alignment:
| Q |
50 |
acacctaagattttcctctttgttgggaagattgtcttagcttactaatcgaccg |
104 |
Q |
| |
|
|||| |||| |||||||||||| ||||| ||||||||||||||| ||||| |||| |
|
|
| T |
32310138 |
acacgtaaggttttcctctttgctgggaggattgtcttagcttaataatctaccg |
32310084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University