View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917_low_29 (Length: 241)
Name: NF9917_low_29
Description: NF9917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 150 - 235
Target Start/End: Complemental strand, 36782058 - 36781973
Alignment:
| Q |
150 |
gactgtccacaaatcttatcataactgataaaatatcgaaatcgttagcttggacgttgtaattgtggtttgattctctgctcctc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
36782058 |
gactgtccacaaatcttatcataactgataaaatatcgaaatcgttagcttggacgttgtgattgtggtttgattctcggctcctc |
36781973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Complemental strand, 36782191 - 36782134
Alignment:
| Q |
18 |
attttgaatagaatatcaacctttgagtcgtgtgataatattatttcttaaaattggt |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36782191 |
attttgaatagaatatcaacctttgagtcgtgtgataatattatttcttaaaattggt |
36782134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University