View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917_low_31 (Length: 238)
Name: NF9917_low_31
Description: NF9917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 64 - 225
Target Start/End: Complemental strand, 32001695 - 32001534
Alignment:
| Q |
64 |
aaaatgggaatttgagttgtttgatatcaattagcgcaattttacaattgctaatcatgatcatcaaattaagattttaattctgactttgtattttgaa |
163 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| | |
|
|
| T |
32001695 |
aaaatgggaatgtgagttgtttgataccaattagcgcaattttacaattgctaatcatgatcgtcaaattaagattttagttctgactttgtattttgga |
32001596 |
T |
 |
| Q |
164 |
ctcgttcattaaaataaaatgtctagannnnnnnngtctagatcggataattgcatcaaatg |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
32001595 |
ctcgttcattaaaataaaatgtctagattttttttgtctagatcgtataattgcatcaaatg |
32001534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 47
Target Start/End: Complemental strand, 32001757 - 32001718
Alignment:
| Q |
8 |
gatcaattgttcagacacatttcacctttgtattttagac |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32001757 |
gatcaattgttcagacacatttcacctttgtattttagac |
32001718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University