View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917_low_34 (Length: 218)
Name: NF9917_low_34
Description: NF9917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 11 - 78
Target Start/End: Complemental strand, 37351917 - 37351850
Alignment:
| Q |
11 |
cgagtttggtggtacatgtttgtaatctaagtaggagcattaaggtgttgaaaggtcctttaacatgt |
78 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37351917 |
cgagtttggtagtacatgtttgtaatctaagtaggagcattaagatgttgaaaggtcctttaacatgt |
37351850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University