View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9918_high_20 (Length: 270)
Name: NF9918_high_20
Description: NF9918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9918_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 152 - 253
Target Start/End: Complemental strand, 25988594 - 25988493
Alignment:
| Q |
152 |
aggaagatatcatgagtcttttctgtgctaaaatgttgcgacaaataacactgctttttgttaacgaacttggatccattagaacacaataaccattata |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988594 |
aggaagatatcatgagtcttttctgtgctaaaatgttgcgacaaataacactgctttttgttagcgaacttggatccattagaacacaataaccattata |
25988495 |
T |
 |
| Q |
252 |
tc |
253 |
Q |
| |
|
|| |
|
|
| T |
25988494 |
tc |
25988493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 21 - 59
Target Start/End: Complemental strand, 25988655 - 25988617
Alignment:
| Q |
21 |
cagaatcttggttaagcacataaattataatgtaataca |
59 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25988655 |
cagaatcttggttaaacacataaattataatgtaataca |
25988617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University