View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9918_high_29 (Length: 216)
Name: NF9918_high_29
Description: NF9918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9918_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 32 - 193
Target Start/End: Original strand, 45112839 - 45112989
Alignment:
| Q |
32 |
ggaaaatatgttaaaaacttatagtgagtgaattcacaaaattcaaagcagtaataaa-tctcgacggtccatctatgattcaatgatatattcttaata |
130 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||| |
|
|
| T |
45112839 |
ggaaaatatgttaaaaacttatagtgagcgaattcacaaaattcaaagcagtaataaaatctcaacggtccatctatgattc------------ttaata |
45112926 |
T |
 |
| Q |
131 |
cacaatccagatctcaatagtttcacacaatgtgaaatctcgatctttcttttaaaatcagac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45112927 |
cacaatccagatctcaatagtttcacacaatgtgaaatctcgatctttcttttaaaatcagac |
45112989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 126 - 175
Target Start/End: Original strand, 4157857 - 4157906
Alignment:
| Q |
126 |
taatacacaatccagatctcaatagtttcacacaatgtgaaatctcgatc |
175 |
Q |
| |
|
|||||| ||||||||||||| ||||||| ||||| ||||| ||||||||| |
|
|
| T |
4157857 |
taatactcaatccagatctcgatagtttgacacagtgtgagatctcgatc |
4157906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University