View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9918_low_19 (Length: 319)
Name: NF9918_low_19
Description: NF9918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9918_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 187 - 302
Target Start/End: Original strand, 14754760 - 14754875
Alignment:
| Q |
187 |
cacttgtttcatcttctgtttttgtttctgtagtagctggtgcttcttccactttctcttctgtgactatgaaagttgataccttctcaaaaacaaagaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14754760 |
cacttgtttcatcttctgtttttgtttctgtagtagctggtgcttcttcaactttctcttctgtgactatgaaagttgataccttctcaaaaacaaagaa |
14754859 |
T |
 |
| Q |
287 |
aactggacctgaaact |
302 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
14754860 |
aactggacctgaaact |
14754875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 6 - 94
Target Start/End: Original strand, 14754579 - 14754667
Alignment:
| Q |
6 |
tttggtggttctacatgttcaaccgcagctggttcaaccggtttttcctcctgtttctcggcaggaggaggagtcggctcagctgcatc |
94 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14754579 |
tttggtggttctacttgttcaaccgcagctggttcaaccggtttttcctcctgtttctcggcaggaggaggagtcggctcagctgcatc |
14754667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University