View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9918_low_22 (Length: 308)
Name: NF9918_low_22
Description: NF9918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9918_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 82 - 294
Target Start/End: Complemental strand, 15495477 - 15495265
Alignment:
| Q |
82 |
aaaaatatcatttaattgccccttgttctacacccgagtatttgacccttacgtccctttttatcttcttgttttatatgttaatacccccaattcctag |
181 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15495477 |
aaaagtatcatttaattgccccttgttctacacccgagtatttgacccttacgtccctttttatcttcttgttttatatgttaatacccccaattcctag |
15495378 |
T |
|
| Q |
182 |
taagtagtaacacagatttgtcgcttttctttcacagaaaggcctcacacaatcatcttttttctggtcttggtatcatctagcacaactctatcaaaat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15495377 |
taagtagtaacacagatttgtcgcttttctttcacataaaggcctcacgcaatcatcttttttctggtcttggtatcatctagcacaactctatcaaaat |
15495278 |
T |
|
| Q |
282 |
gtgttgtagtttt |
294 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15495277 |
gtgttgtagtttt |
15495265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 12 - 80
Target Start/End: Complemental strand, 15496099 - 15496031
Alignment:
| Q |
12 |
tgttgagaagctcgtacgttgnnnnnnngttatgttggattgtggtgtttcgtggtggttttcatggtg |
80 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15496099 |
tgttgagaagctcgtacgttgtttttttgttatgttggattgtggtgtttcgtggtggttttcatggtg |
15496031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 40 - 80
Target Start/End: Complemental strand, 40681068 - 40681028
Alignment:
| Q |
40 |
gttatgttggattgtggtgtttcgtggtggttttcatggtg |
80 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
40681068 |
gttatgttggattgtggtgtttcatggtggtttttatggtg |
40681028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University