View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9918_low_34 (Length: 248)
Name: NF9918_low_34
Description: NF9918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9918_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 4 - 233
Target Start/End: Complemental strand, 32462356 - 32462129
Alignment:
| Q |
4 |
taatagtcattttttatagtctacctggagtgatctagtgtacctggagtgatctagaaaaactagagttagaaaatgcagatatgcaccctgctaagga |
103 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32462356 |
taatagtcattttttatagtctacctgcagtgatctagtctacctggagtgatctagaaaaactagagttagaaaatgcagatatgcaacctgctaagga |
32462257 |
T |
 |
| Q |
104 |
aattgttgccctgcccttatctgctttgggggaacctttttaattaaagaagcaataaccatttttatggaacaaatgaacttctatatatattcaaaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
32462256 |
aattgttgccctgcccttatctgctttgttggaacctttttaattaaagaagcaataaccatttttatggaacaaatgaacttc--tttatattcaaaac |
32462159 |
T |
 |
| Q |
204 |
gttaacagcattcattctgtcagcagattt |
233 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
32462158 |
gttaaaagcattcattctgtcagcagattt |
32462129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University