View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9919_low_23 (Length: 229)
Name: NF9919_low_23
Description: NF9919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9919_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 4 - 175
Target Start/End: Original strand, 7948831 - 7949003
Alignment:
| Q |
4 |
aaaataaactcattacctccaagttaattgcataaaacaccaaaatacatagagatgtgataaaatccaagtgaccgaaatattcatgtctatagaaatg |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7948831 |
aaaataaacacattacctccaagttaattgcataaaacaccaaaatacatagagatgtgataaaatccaagtgaccgaaatatttatgtctatagaaatg |
7948930 |
T |
 |
| Q |
104 |
taacattga-ccctgaatcattttgacggaatatgtaatttattaaatttgttttgtcaatctaaaccagacg |
175 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
7948931 |
taacattgacccctgaatcattttgattgaatatgtaatctattaaatttgttttgtcaatctaaatcagacg |
7949003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University