View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9920_high_23 (Length: 274)
Name: NF9920_high_23
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9920_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 259
Target Start/End: Complemental strand, 56277641 - 56277392
Alignment:
| Q |
13 |
cagagatagatggttggatttggggaaggaaaacaggtacggcagcaaagaattcctttacaagatgacaaaagcacaacatcttgaggaagaaaagaaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || | ||||| ||||||||||||||||||||||||| |
|
|
| T |
56277641 |
cagagatagatggttggatttggggaaggaaaacaggtacggcagcaaacaattcctttacaggaagccaaaacaacaacatcttgaggaagaaaagaaa |
56277542 |
T |
 |
| Q |
113 |
aaacattgtggtgaacaactagtttagcagc---gtttttgggttggacaggaatgtaactaatggttttaacatcgtgtttgcagaacatgtacctatc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56277541 |
aaacattgtggtgaacaactagtttagcagcgttgtttttgggttccacaggaatgtaactaatggttttaacatcgtgtttgcagaacatgtacctatc |
56277442 |
T |
 |
| Q |
210 |
ttgaacaataaaagcatttaaaacaagattagtgtttttgagttgatctt |
259 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
56277441 |
ttgaacaataaaaccatttaaaacaagatttgtgtttttgagttgatctt |
56277392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University