View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9920_high_24 (Length: 273)
Name: NF9920_high_24
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9920_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 19 - 243
Target Start/End: Complemental strand, 33034281 - 33034057
Alignment:
| Q |
19 |
gaaatttgagaaactcttttactatcatctccttatcttaaagcttttcttgccatgtttttgtcaccactaaagtagtttcatctctaaactattccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33034281 |
gaaatttgagaaactcttttactatcatctccttatcttaaagcttttcttgccatgtttttgtcaccactaaagtagtttcatctctaaactattccaa |
33034182 |
T |
 |
| Q |
119 |
gtaagtttttctttgcgtttgttttcttagaatgaaaatctttgtagattttaatgaaacaagcatctgcatgcacttctttgtttttggatactttgat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33034181 |
gtaagtttttctttgcgtttgttttcttagaatgaaaatctttgtagattttaatgaaacaagtatctgcatgcacttctttgtttttggatactttgat |
33034082 |
T |
 |
| Q |
219 |
gttgttagttctctatattaatgtt |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33034081 |
gttgttagttctctatattaatgtt |
33034057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University