View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9920_high_36 (Length: 218)

Name: NF9920_high_36
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9920_high_36
NF9920_high_36
[»] chr8 (1 HSPs)
chr8 (117-201)||(7996096-7996180)


Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 117 - 201
Target Start/End: Original strand, 7996096 - 7996180
Alignment:
117 ttgacttcgccaaatgcactccatgatggcctttgcagcttaatttcccagagaagttgaggaggtaattttgccatggcttcct 201  Q
    ||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||| || ||||||||    
7996096 ttgacttcgccaaatgcactccaagattgcctttgcggcttaatttcccagagaagttgaggaggtaattttgacacggcttcct 7996180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University