View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9920_high_36 (Length: 218)
Name: NF9920_high_36
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9920_high_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 117 - 201
Target Start/End: Original strand, 7996096 - 7996180
Alignment:
| Q |
117 |
ttgacttcgccaaatgcactccatgatggcctttgcagcttaatttcccagagaagttgaggaggtaattttgccatggcttcct |
201 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
7996096 |
ttgacttcgccaaatgcactccaagattgcctttgcggcttaatttcccagagaagttgaggaggtaattttgacacggcttcct |
7996180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University