View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9920_low_21 (Length: 301)
Name: NF9920_low_21
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9920_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 29009270 - 29008983
Alignment:
| Q |
1 |
tcttcttcattgctctgagatttcactttctgaatttgcaggtacataaccaaattctctgttctgaattcataacaaactcttcaaccgcgcaaagatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29009270 |
tcttcttcattgctctgagatttcactttctgaatttgcaggtacataaccacattctctgttctgaattcataacaaactcttcaaccgcgcaaagatc |
29009171 |
T |
 |
| Q |
101 |
atatatgttcgcttcaacttcttgattaaattcttcaaattccgattctggtttcattttattcaaattcaccttcacatttctatataatttgcatttg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29009170 |
atataggttcgcttcaacttcttgattacattcttcaaattccgattctggtttcattttattcaaattcaccttcacatttctatataatttgcatttg |
29009071 |
T |
 |
| Q |
201 |
cacgctactattttcactgaaactaattcttcaatttcatttgacactgttacggtgttatattcattcaattagatgaagaatttga |
288 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
29009070 |
cacgctacaattttcactgaaactaattcttcaattgcatttgatactgttacggtgttgtattcattcgattagatgaagaatttga |
29008983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University