View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9920_low_29 (Length: 265)
Name: NF9920_low_29
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9920_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 27974504 - 27974257
Alignment:
| Q |
9 |
tggagttgttggaataaattttgaaaaag---ttctcttagttggaccttttcgagatagtaacatcgaaggacttcgaaaatctttctttggaaccttt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27974504 |
tggagttgttggaataaattttgaaaaagaagttctcttagttggaccttttcgggatagcaacatcgaaggacttcgaaaatctttctttggaaccttt |
27974405 |
T |
 |
| Q |
106 |
ggaacgactgatttttgaatttggttgttgaagtcaggagatggagaaactgttcctgtgtcttcttcgtcgtcgtcgtc---atcaatatggtgtggaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
27974404 |
ggaacgactgatttttgaatttggttgttgaagtcaggagatggagaaattgttcctgcgtcactttcttcgtcgtcgtcatcatcaatatggtgtggaa |
27974305 |
T |
 |
| Q |
203 |
cttgatcagggaagacacttgcaatagttctgtttgcactttgaagtt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27974304 |
cttgatcagggaagacacttgcaatagttctgtttgcactttgaagtt |
27974257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University