View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9920_low_31 (Length: 247)
Name: NF9920_low_31
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9920_low_31 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 22 - 247
Target Start/End: Complemental strand, 2701194 - 2700969
Alignment:
| Q |
22 |
ctatccaacataaactaacttatctcatcaaaagagtcaatctataaaaagaaaaacgaagtgcactaaagattattattattatttctgaataagagat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2701194 |
ctatccaacataaactaacttatctcatcaaaagagccaatctataaaaagaaaaacgaagtgcactaaagattattattattatttctgaataagagat |
2701095 |
T |
 |
| Q |
122 |
aagcattgtccatagtcttggtaaactaagaagtagcaaacaacaaaactctgcctctatctttcttgaaactatcaatggaaggagaaggtgataagtg |
221 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2701094 |
aaacattgtccatagtcttggtaaactaagaagtagcaaacaacaaaactctacctctatctttcttgaaactatcaatggaaggtgaaggtgataagtg |
2700995 |
T |
 |
| Q |
222 |
gcagcagtgtaatgaagatgttgctc |
247 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
2700994 |
gcagcagtgtagtgaagatgttgctc |
2700969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 240
Target Start/End: Complemental strand, 10843596 - 10843537
Alignment:
| Q |
181 |
tctttcttgaaactatcaatggaaggagaaggtgataagtggcagcagtgtaatgaagat |
240 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
10843596 |
tcttccttgaaaatatcaatggaaggagaaggtgataagtggcagaggtgtgatgaagat |
10843537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University