View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9920_low_41 (Length: 227)
Name: NF9920_low_41
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9920_low_41 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 1566254 - 1566028
Alignment:
| Q |
1 |
tcagcagcaggttggaataaattaacttccttaccctgtaattttagaagattataaatcaatatagggaccctttagaaagatacttctagaactagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1566254 |
tcagcagcaggttggaataaattaacttccttaccctgtaattttagaagattataaatcaatatagggaccctttagaaagatacttctagaactagat |
1566155 |
T |
 |
| Q |
101 |
agacaaagtgaagtaatatcagaaacatatgctagatagaaacgatgaattaaaaaccggtaccttcttatcagtagacctaatgcagttagggtgatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1566154 |
agacaaagtgaagtaatatcagaaacatatgctagatagaaacgatgaattaaaaactggtaccttcttatcagtagacctaatgcagttagggtgatta |
1566055 |
T |
 |
| Q |
201 |
tcagatatagactgtctaagaggacca |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1566054 |
tcagatatagactgtctaagaggacca |
1566028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 12907964 - 12908009
Alignment:
| Q |
1 |
tcagcagcaggttggaataaattaacttccttaccctgtaatttta |
46 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| ||||||||||||| |
|
|
| T |
12907964 |
tcagcagcaggttggaataaattaaccttcttgccctgtaatttta |
12908009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University