View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9920_low_45 (Length: 216)
Name: NF9920_low_45
Description: NF9920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9920_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 45164615 - 45164801
Alignment:
| Q |
13 |
gcaaagggggaaaaggaaatcttaagcgctgttagtgctaaacttaactactcaagaatggctgataagaagagttcaattgctattttcgactttcagt |
112 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45164615 |
gcaaaaggggaaaaggaaaccttaagcgctgttagtgctaaacttaactactcaagaatggctgataagaagagttcaattgctattttcgactttcagt |
45164714 |
T |
 |
| Q |
113 |
tgttagagtctgcaacaaacagcttttccgaagataatatcatgggagagactggttctataattgtttacagagctcgttttgatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45164715 |
tgttagagtctgcaacaaacagcttttcccaagataatatcatgggagagactggttctataattgtttacagagctcgtttcgatg |
45164801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University