View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9921_low_1 (Length: 322)
Name: NF9921_low_1
Description: NF9921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9921_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 32163489 - 32163793
Alignment:
| Q |
1 |
attggaaaatattgttatgggaaagttacttcatgttctggtagttaagtatggattggatgatacttcattgaggaattctcttgttgatatgtatgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163489 |
attggaaaatattgttatgggaaagttacttcatgttctggtagttaagtatggattggatgatacttcattgaggaattctcttgttgatatgtatgcg |
32163588 |
T |
 |
| Q |
101 |
aagtgtggacttattcctgatgcacattatgtgtttgcaactacggtggataaggatgttgtttcttggaattcggttatttcgggttatgcacagagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163589 |
aagtgtggacttattcctgatgcacattatgtgtttgcaactacggtggataaggatgttgtttcttggaattcggttatttcgggttatgcacagagtg |
32163688 |
T |
 |
| Q |
201 |
gatcagcatatgaagcccttgagctcttcaacaggatgagaatggaatcgtttttgccagatgcggttacggttgttggtgttctctcagcttgtgcttc |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32163689 |
gatcagcatatgaagcccttgatctcttcaacaggatgagaatggaatcgtttttgccagatgcggttacggttgttggtgttctctcagcttgtgcttc |
32163788 |
T |
 |
| Q |
301 |
tgttg |
305 |
Q |
| |
|
||||| |
|
|
| T |
32163789 |
tgttg |
32163793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University