View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9922_13 (Length: 304)
Name: NF9922_13
Description: NF9922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9922_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 44 - 143
Target Start/End: Original strand, 8682744 - 8682843
Alignment:
| Q |
44 |
gtgatgacaacaaaacggccaatgaaggcggtggtaaaaatgcaggtggtggcacaaaagtagaggaagtgaagccagcaccacagccagtgaacgagca |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8682744 |
gtgatgacaacaaaacggccaatgaaggcggtggtaaaaatgcaggtggtggctcaaaagtagaggaagtgaagccagcaccacagccagtgaaagagca |
8682843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 145 - 257
Target Start/End: Original strand, 26133028 - 26133140
Alignment:
| Q |
145 |
aacctgtgatttactctannnnnnncttcttttcctgaaactctttttcttcctcttagtaagacttgttgttttggtactgatcattaggtgaaatgta |
244 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26133028 |
aacctgtgatttactctatttttttgttcttttcctgaaactctttttcttcctcttagtaagacttgttgttttggtactgatcattaggtgaaatgta |
26133127 |
T |
 |
| Q |
245 |
tctatactctact |
257 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26133128 |
tctatactctact |
26133140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University