View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9922_8 (Length: 346)
Name: NF9922_8
Description: NF9922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9922_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 32165123 - 32165456
Alignment:
| Q |
1 |
ttgggcctgtctttaaaacggggaaatgttggttgcagaatggtcattctcagcatacactactttctacaaaaacagtagatttagctagttcaagtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165123 |
ttgggcctgtctttaaaacggggaaatgttggttgcagaatggtcattctcagcatacactactttctacaaaaacagtagatttagctagttcaagtca |
32165222 |
T |
|
| Q |
101 |
ctcctttttgcataaccactcacaaacatcccaaacaagcaggcataggcgttacagtaaaataaaattgttggaaacaaatacttttgactgtaacact |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165223 |
ctcctttttgcataactactcacaaacatcccaaaca-gcaggcataggcgttacagtaaaataaaattgttggaaacaaatacttttgactgtaacact |
32165321 |
T |
|
| Q |
201 |
tgaacttttcagatgatacatacattgtatagttacattcatgatattttatttgaaatagtgaatatatctattcatttatttagttgcaatcacattt |
300 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165322 |
tgaacttttcagataatacatacattatatagttacattcatgatattttatttgaaatagtgaatatatctattcatttatttagttgcaatcacattt |
32165421 |
T |
|
| Q |
301 |
atacatcactctgtttttgcgcttcttcactccca |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165422 |
atacatcactctgtttttgcgcttcttcactccca |
32165456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University