View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9922_low_4 (Length: 267)
Name: NF9922_low_4
Description: NF9922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9922_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 256
Target Start/End: Complemental strand, 46284053 - 46283800
Alignment:
| Q |
18 |
agagggaaccaataactactacaacattctcaaatagatgtgatggatagatatagatacatcatacatggacatctact---------------tatac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46284053 |
agagggaaccaataactactacaacattctcaaatagatgtgatggatagatatagatacatcatacatggacatctactatatatctacaatactatac |
46283954 |
T |
 |
| Q |
103 |
accacaaagaaagagtgatggtgcatctctttttggtgaaagtgatgttctgagcaaccccagtcaaagggagcatattggctagctagctacaagtata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46283953 |
accacaaagaaagagtgatggtgcatctctttttggtgaaagtgatgttctgagcaaccccagtcaaagggagcatattggctagctagctacaagtata |
46283854 |
T |
 |
| Q |
203 |
ctgcatacatatatatggatggttggttggatagaaataataattgtactctct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46283853 |
ctgcatacatatatatggatggttggttggatagaaataataattgtactctct |
46283800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University