View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9922_low_5 (Length: 254)
Name: NF9922_low_5
Description: NF9922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9922_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 50 - 239
Target Start/End: Original strand, 47195591 - 47195779
Alignment:
| Q |
50 |
tttattaaccgagttaagctcacgaagaccgagttcacttgatctataacaagtattgtctttattaaatgaaggaaagcaccannnnnnnnnattacaa |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47195591 |
tttattaaccgagttaagctcacggagaccgagttcacttgatctataacaagtattgtctttattaaatgaaggaaagcaccatttttctt-attacaa |
47195689 |
T |
|
| Q |
150 |
tgatgatgaccacccacatatattaatcagcttccaaataattatgattacataaaaatcaataatataatgtatttctatcaacaaatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47195690 |
tgatgatgaccacccacatatattaatcagcttccaaataattatgattacataaaaatcaataatataatgtatttctatcaacaaatt |
47195779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University