View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9923_11 (Length: 334)
Name: NF9923_11
Description: NF9923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9923_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 325
Target Start/End: Original strand, 24925025 - 24925344
Alignment:
| Q |
1 |
cttttatggctttgcaaacccaattccgtatcgaatgacttgggacattcctcaaaatcgcatttgtaaactttgtatggttcagtactcatcgttattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24925025 |
cttttatggctttgcaaacccaattccgtatcgaatgacttgggacattcctcaaaatcgcatttgtaaactttgtatggttcagtactcatcgttattc |
24925124 |
T |
|
| Q |
101 |
gtgatttgaccaaaataacacaaattatagagtgaattagagggtaagataaaccacattttcagaaatttatatgaatcacaaatttatgttatatcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24925125 |
gtgatttgaccaaaataacacaaattataga-----ttagagggtaagataaaccacattttcagaaatttatatgaatcacaaatttatgttatatcac |
24925219 |
T |
|
| Q |
201 |
taaattatttaacacttgtatacacgcttgatcaataattatttacagaatgcgctagaatttaagatatcactaaatgattttgaacgtgaaatcatga |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24925220 |
taaattatttaacacttgtgtacacgcttgatcaataattatttacagaatgcgctagaatttaagatatcactaaatgattttgaacgtgaaatcatga |
24925319 |
T |
|
| Q |
301 |
cattgaaggtttaatgaagaataat |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
24925320 |
cattgaaggtttaatgaagaataat |
24925344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University