View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9924_low_10 (Length: 244)
Name: NF9924_low_10
Description: NF9924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9924_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 244
Target Start/End: Complemental strand, 36467788 - 36467555
Alignment:
| Q |
11 |
ggacatcaaatatttcaattgagattcgaatattaattcactaagaccatacggaagcaccatctctctcttcattttgaatctcatttaaaaaatctta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
36467788 |
ggacatcaaatatttcaattgagattcgaatattagttcactaagatcatatggaagcaccatctctctcttcattttgggtctcatttaataaatctta |
36467689 |
T |
 |
| Q |
111 |
ataaaattgatacttattaagtatgtggtgatatgaattcaatttaaacatctaatttaaggtgattgttgtggatggtctaaaatgtgaaagtggtgac |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
36467688 |
ataaaattgatacttattaagtatgtgatgatatgaattcaatttaaacatctaatttagggtgcttgttgtggatggtctaagatgtgaaagtggtgac |
36467589 |
T |
 |
| Q |
211 |
tcattcctctatgccaatccccattgtttaattt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36467588 |
tcattcctctatgccaatccccattgtttaattt |
36467555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University