View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9924_low_11 (Length: 239)
Name: NF9924_low_11
Description: NF9924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9924_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 28488643 - 28488789
Alignment:
| Q |
1 |
attgattttagcttttattttgctaaagcaattggttgtatttatgaacaatgagaagtttattgtatgctaccagcacaagaacaattaagaaataagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
28488643 |
attgattttagcttttattttgctaaagcaattggttgtatttatcaacaatgagaagtttattgtatggtaacagcacaagaacaattaagaaataagt |
28488742 |
T |
 |
| Q |
101 |
tttctattgatccaaacaaatattacatggtgaaaatgtcaaaacta |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28488743 |
tttctattgatccaaacaaatattacatggtgaaaatgtccaaacta |
28488789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 30 - 90
Target Start/End: Original strand, 28466901 - 28466961
Alignment:
| Q |
30 |
aattggttgtatttatgaacaatgagaagtttattgtatgctaccagcacaagaacaatta |
90 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||| |||||| |||||||| |
|
|
| T |
28466901 |
aattggttgtatttattaacaatgaaaagtttattgtatggtacatgcacaacaacaatta |
28466961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 111 - 157
Target Start/End: Original strand, 28467021 - 28467067
Alignment:
| Q |
111 |
tccaaacaaatattacatggtgaaaatgtcaaaactacagaaactct |
157 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| | ||||||| |
|
|
| T |
28467021 |
tccaaacaaatattacatagtgaaaatgtcaaaactagataaactct |
28467067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 218
Target Start/End: Original strand, 28467093 - 28467145
Alignment:
| Q |
166 |
aaacatgtctgttactggaaactaattgtcatgctccaatggttagaagcttc |
218 |
Q |
| |
|
|||||||||||| | || ||||| |||||||||||||||||| ||||||||| |
|
|
| T |
28467093 |
aaacatgtctgtcatagggaactagttgtcatgctccaatggtcagaagcttc |
28467145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University