View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9925_high_22 (Length: 266)
Name: NF9925_high_22
Description: NF9925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9925_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 7631722 - 7631569
Alignment:
| Q |
1 |
aaaatagatgcagaattatatctctagaacaatatctgcaagaagaagaaaaaacttcattagtccatatagagtatgatatttataattatgttgttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7631722 |
aaaatagatgcagaattatatctctagaacaatatctgcaagaagaagaaaaaacctcattagtccatatagagtatgatgtttataattatgttgttgc |
7631623 |
T |
 |
| Q |
101 |
ataaatatgaatgtgaaaatgaatttacattcagaatcagtcttgacccattta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7631622 |
ataaatatgaatgtgaaaatgaatttacattcagaatcagtcttgacccattta |
7631569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University