View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9925_high_28 (Length: 244)
Name: NF9925_high_28
Description: NF9925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9925_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 33706298 - 33706082
Alignment:
| Q |
18 |
ttaagattctagattcattatattctagtagctttcatttgcttttgggtgaaccttaatgtttggttcttatttgttgcagattgatggggtaaactat |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33706298 |
ttaagattctagattcgttatattctagtagctttcatttgcttttgggtgaaccttaatgtttggttcttatttgttgcagattgatggggtaaactat |
33706199 |
T |
|
| Q |
118 |
tttgtttgtgtgttgtttgaagtgacacaataaggctcagattgatttgtgtgagtataagaggaagctataatgcatctctcactatggaagcctattt |
217 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33706198 |
tttgtttgtgtgttgtttgtagtgatacaataaggctcagattgatttgtgtgagtataagaggaagctataatgcatctctcactatggaagcctattt |
33706099 |
T |
|
| Q |
218 |
ctcactgtgcttctctg |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33706098 |
ctcactgtgcttctctg |
33706082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 179 - 230
Target Start/End: Complemental strand, 33723721 - 33723670
Alignment:
| Q |
179 |
aggaagctataatgcatctctcactatggaagcctatttctcactgtgcttc |
230 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
33723721 |
aggaagctacaatgcatctttcactatggaagcccatttctcactgtgcttc |
33723670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University