View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9925_high_34 (Length: 229)

Name: NF9925_high_34
Description: NF9925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9925_high_34
NF9925_high_34
[»] chr3 (2 HSPs)
chr3 (104-215)||(8911677-8911788)
chr3 (14-47)||(8911647-8911680)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 8911677 - 8911788
Alignment:
104 gcaaagagattgtttccaagatttgaatctcaaaactcgaattcaaaatgcaacaattttacagttgcgtcaaggctcgccttcgatattaataaaagct 203  Q
    ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8911677 gcaaagagattgttttcaagatttgaatctcaaaactcgaattcacaatgcaacaattttacagttgcgtcaaggctcgccttcgatattaataaaagct 8911776  T
204 atagtacttttt 215  Q
    ||||||||||||    
8911777 atagtacttttt 8911788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 8911647 - 8911680
Alignment:
14 cagagacaatagagcagcccaatgcacgaggcaa 47  Q
    |||| |||||||||||||||||||||||||||||    
8911647 cagaaacaatagagcagcccaatgcacgaggcaa 8911680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University