View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9925_high_37 (Length: 209)
Name: NF9925_high_37
Description: NF9925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9925_high_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 93 - 187
Target Start/End: Complemental strand, 30203541 - 30203447
Alignment:
| Q |
93 |
tagatgattgttttccatggtgtccatagataaacaaagacaagcttatggaaaacattattagacctccaattagaaaatgaatatagcaaact |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||| ||| ||||||||| |
|
|
| T |
30203541 |
tagatgattgttttccatggtgtccatagacaaacaaagacaagcttatggaaaacattattaaaactccaattagaaaataaatgtagcaaact |
30203447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University