View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9925_low_18 (Length: 312)
Name: NF9925_low_18
Description: NF9925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9925_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 52234818 - 52234521
Alignment:
| Q |
1 |
atttgaagaagaaaacacaggttccaaagatacaagagcgagaaatttctgattctgttgtgggaaataacaacgtctctttggacagcacatgttcctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52234818 |
atttgaagaagaaaacacaggttccaaagatacaagagcgggaaatttctgattctgttgtgggaaataacaacgtctctttggacagcacatgttcctc |
52234719 |
T |
 |
| Q |
101 |
ggattcctcttcaggaaattcattggtgaaaaaggtcaactctgagaatggaaatggaagtgcaaagatgaagcgcaataacgggtttaagccagtgagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52234718 |
ggattcctcttcaggaaattcattggtgaaaaaggtcaactctgagaatggaaatggaagtgcaaagatgaagcgcaataacgggtttaagccagtgagg |
52234619 |
T |
 |
| Q |
201 |
attgttccagatgcttcccacgtgtctccgcctcataaggcctcggcaccgtccaagagatgtgattggatcacaccaaatgctggtaaatctgtgct |
298 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52234618 |
attgtcccagatgcttcccacgtgtctccgcctcataagacctcggcaccgtccaagagatgtgattggatcacaccaaatgctggtaaatctgtgct |
52234521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University