View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9925_low_35 (Length: 241)
Name: NF9925_low_35
Description: NF9925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9925_low_35 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 52861142 - 52860919
Alignment:
| Q |
18 |
gttattattgttgttgtcttcattgcaaaacagtgttgtggggacaaaaccagaaagttgattcctggaaagtgacagcacttgaagctttggcatagtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52861142 |
gttattattgttgttgtcttcattgcaaaacagtgttgtggggacaaaaccagaaagttgattcctggaaagtgacagcacttgaagctttggcatagtc |
52861043 |
T |
|
| Q |
118 |
cctatcgtagaaggaacgaacccaccaatgaaattatcctctgcactaaggtgcaccatagaagaacagtttgcaacagcagaaggtaacgttccatgaa |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52861042 |
cctatcgtggaaggaacgaacccaccaatgaaattatcctctgcactaaggtgcaccatagaagaacagtttgcaacagcagaaggtaacgttccatgaa |
52860943 |
T |
|
| Q |
218 |
gatggttgctgtctaaccacagat |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
52860942 |
gatggttgctgtctaaccacagat |
52860919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University