View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9925_low_41 (Length: 229)
Name: NF9925_low_41
Description: NF9925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9925_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 104 - 215
Target Start/End: Original strand, 8911677 - 8911788
Alignment:
| Q |
104 |
gcaaagagattgtttccaagatttgaatctcaaaactcgaattcaaaatgcaacaattttacagttgcgtcaaggctcgccttcgatattaataaaagct |
203 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8911677 |
gcaaagagattgttttcaagatttgaatctcaaaactcgaattcacaatgcaacaattttacagttgcgtcaaggctcgccttcgatattaataaaagct |
8911776 |
T |
 |
| Q |
204 |
atagtacttttt |
215 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8911777 |
atagtacttttt |
8911788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 8911647 - 8911680
Alignment:
| Q |
14 |
cagagacaatagagcagcccaatgcacgaggcaa |
47 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
8911647 |
cagaaacaatagagcagcccaatgcacgaggcaa |
8911680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University