View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9926_high_18 (Length: 296)
Name: NF9926_high_18
Description: NF9926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9926_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 14781896 - 14782184
Alignment:
| Q |
1 |
atagagatagatttattacaaactattttagttttatccaatcacacatacttgagaattgagctcttgacaaaagggaagataaatctagatgacaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14781896 |
atagagatagatttattacaaactattttagttttgtccaatcacacatacttgagaattgagctcttgacaaaagggaagataaatctagatgacaagc |
14781995 |
T |
|
| Q |
101 |
ccggcttatttaaacaaagaaaaatgctaaccagtgtcc-tgagacactaatcaaggctaacccacaatacccttcagcacctcaaccaacctcaggtgt |
199 |
Q |
| |
|
||| |||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14781996 |
ccgacttatttaaacaaaaaaaaatgctaaccagtgtccctgaaacactaatcaaggctaacccacaatacccttcagcacctcaaccaacctcaggtgt |
14782095 |
T |
|
| Q |
200 |
gcagttaactgagggaaatggccagtcatgtctataaactccaaagtagacacccctttaatgttttcatccaagtaatgccctatgct |
288 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14782096 |
gcagttaactgagggcaatggccagtcatgtctataaactccaaagtagacactcctttaatgttttcatccaagtaatgccctatgct |
14782184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University