View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9926_high_25 (Length: 230)
Name: NF9926_high_25
Description: NF9926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9926_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 7624519 - 7624743
Alignment:
| Q |
1 |
tcggtttgtcaatctcccttaatgttcttacgacaattttttgttgcctcctagcctttatcaccagttttcatcactaggtttggtcatattatcattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624519 |
tcggtttgtcaatctcccttaatgttcttacgacaattttttgttgcctcctagcctttatcaccagttttcatcactaggtttggtcatattatcattg |
7624618 |
T |
 |
| Q |
101 |
atattttaaacttgtttttaatgtatggtccacggtggaccatttatgaacacattgtcatattagaatttgccatccccccatattgtggcttaaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7624619 |
atattttaaacttgtttttaatgtatggtccacggtggaccatttatgaacacattgtcatattagaatttgccatccccccatactgtggcttaaacaa |
7624718 |
T |
 |
| Q |
201 |
caaacacgtttttatcacctatgct |
225 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
7624719 |
caaacacgtttttatcacccatgct |
7624743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University