View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9926_low_24 (Length: 265)
Name: NF9926_low_24
Description: NF9926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9926_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 48 - 249
Target Start/End: Complemental strand, 7982003 - 7981806
Alignment:
| Q |
48 |
actattctaccaaataaatactccaagtatactatgactatgagtgctctaacgtggcaagatatactagtagttcttatatatataaatacacattaga |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7982003 |
actattctaccaaataaatactccaagtatactatgactatgagtgctctaacgtggcaagatatactagtagttcttatata----aatacacattaga |
7981908 |
T |
 |
| Q |
148 |
ctaatgttcatttagattagaatcaccatatcataattatttggttgctattttctaaccaaaccaaaacgttgttcttggtttgcttgctctctacctt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7981907 |
ctaatgttcatttagattagaatcaccatatcataattatttggttgctattttctaaccaaaccaaaacgttgttcttggtttgcttgctctctccctt |
7981808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University