View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9926_low_27 (Length: 258)
Name: NF9926_low_27
Description: NF9926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9926_low_27 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 258
Target Start/End: Original strand, 1885586 - 1885835
Alignment:
| Q |
8 |
agatgaaaagcaaagagtgaaataccaatttgcctttgcaattgtagagattggacaatttagtttttgaaatttgatggaatttcaaaataattcttga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885586 |
agatgaaaagcaaagagtgaaataccaatttgcctttgcaattgtagagatcggacaatttagtttttgaaatttgatggaatttcaaaataattcttga |
1885685 |
T |
|
| Q |
108 |
aattgggagattctcgatgaaattaatttctgttgaataattttagtaactaaattgaccgactcaaaaggaataatgtggtcgaggattctcaattcaa |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885686 |
aattgg-agattctcgatgaaattaatttctgttgagtaattttagtaactaaattgaccgactcaaaaggaataatgtggtcgaggattctcaattcaa |
1885784 |
T |
|
| Q |
208 |
agactattttatagactaagttgacaatatcgtattattttagggacaact |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885785 |
agactattttatagactaagttgacaatatcgtattattttagggacaact |
1885835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University