View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9926_low_32 (Length: 230)
Name: NF9926_low_32
Description: NF9926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9926_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 9803743 - 9803944
Alignment:
| Q |
14 |
cagagagctaaatctctcttatacattgaccatgtgccttgcgcatgttgttgcgtgctacaagttggatgaaaaa-cctataatttgaactcaaaccca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
9803743 |
cagagagctaaatctctcttatacattgatcatgtgccttgcgcatgttgttgcgtgctacaagttggatgaaaaagcctataacttgaactcaaaccca |
9803842 |
T |
 |
| Q |
113 |
attgaaaatatgcccctaaatagattatcttccaaacacaaatgttcattcaaaacatgcggttcaagaagaaggttagaactagaagcatcaaggagga |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
9803843 |
attgaaaatatgcctataaatagattatcttccaaacacaaatgttcattcaaaacatgtggttcaagaggaaggttggaactagaagcatcaaggagga |
9803942 |
T |
 |
| Q |
213 |
gt |
214 |
Q |
| |
|
|| |
|
|
| T |
9803943 |
gt |
9803944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University