View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9926_low_5 (Length: 486)
Name: NF9926_low_5
Description: NF9926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9926_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 411; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 411; E-Value: 0
Query Start/End: Original strand, 46 - 484
Target Start/End: Original strand, 3415233 - 3415671
Alignment:
| Q |
46 |
acttgatcaatcatcatccactatcactacacatcactcaaacaaaacgttgttaaacaaacattgtcaccaacgttgttcttcatcaatcttctaccca |
145 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3415233 |
acttgatcaatcatcatcccttatcactacacatcactcaaacaaaacgttgttaaacgaacattgtcacctacgttgttcttcatcaatcttctaccca |
3415332 |
T |
|
| Q |
146 |
tggattccaagaccattcttgattatgctctgtttcaactcacaccaactagaacaaggtattttctcacaacccattctgttatattatcttatttcat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3415333 |
tggattccaagaccattcttgattatgctctgtttcaactcacaccaactagaacaaggtattttctcacaacccattctgttatattatcttatttcat |
3415432 |
T |
|
| Q |
246 |
tgttttcttcttaaaaatttgtgctttttcacaattgacttattgggttgttttgtttttgattcataaattttgtagattcgagcttttggtgtttaat |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3415433 |
tgttttcttcttaaaaatttgtgctttttcacaattgacttatcgggttgttttgtttttgattcataaattttgtagattcgagcttttggtgtttaat |
3415532 |
T |
|
| Q |
346 |
ggagctgttcgtgagaaaatagcttctgggttatttgaacctttcatttctcatctcaaatttgttaaagatgagatctccaaaggtggatactctatta |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3415533 |
ggagctgttcgtgagaaaatagcttctgggttatttgaacctttcatttctcatctcaaatttgttaaagatgagatctccaaaggtggatactctatta |
3415632 |
T |
|
| Q |
446 |
ggctattgcctccatccaacactgctctctgcttctcca |
484 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
3415633 |
ggctattgcctccatccaacactgctttctggttctcca |
3415671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University