View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9928_high_1 (Length: 460)
Name: NF9928_high_1
Description: NF9928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9928_high_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 153 - 453
Target Start/End: Original strand, 11612646 - 11612946
Alignment:
| Q |
153 |
agtgtatttatcaaaggataagcttacaagggttatcttagaaattgcttaatgttaaagattttgttatggttggttggtatgactgtgagagtggacc |
252 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11612646 |
agtgtatttatcaaaggataagcttaaaagggttacattagaaattgcttaatgttaaagattttgttatggttggttggtgtgactgtgagagtggacc |
11612745 |
T |
|
| Q |
253 |
tgttacagttcagctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtc |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612746 |
tgttacagttcagctggtctttatcttcaacatgaagccttttttaattttcatgtttctatatagtttggtatgatgtaatctagcttctgcttttgtc |
11612845 |
T |
|
| Q |
353 |
ctcactctaattgattttgtaaattatttccattgatctagtttcttctgcatgtttggtttgccttttagtcttaaggtccttttctttttcctttgct |
452 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612846 |
ctcactctaattgattttgtaaagtatttccattgatctagtttcttctgcatgtttggtttgccttttagtcttaaggtccttttctttttcctttgct |
11612945 |
T |
|
| Q |
453 |
t |
453 |
Q |
| |
|
| |
|
|
| T |
11612946 |
t |
11612946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University