View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9928_high_3 (Length: 250)
Name: NF9928_high_3
Description: NF9928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9928_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 30 - 243
Target Start/End: Complemental strand, 46772931 - 46772718
Alignment:
| Q |
30 |
gttccttctatcttaattgattgattaagttgctattaatagttgtattgcctagttttcttaaaaaattaaataaatatttgtattgtacgttattaac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46772931 |
gttccttctatcttaattgattgattaagttgctattaatagttgtattgcctagttttctttaaaaattaaataaatatttgtattgtatgttattaac |
46772832 |
T |
 |
| Q |
130 |
tcaattgtttatgttatgttgataatttgaaggatcaagaatagtgcacaaaaaacatctccgctggggaagtttcccaaaccagctaatttaggaggta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46772831 |
tcaattgtttatgttatgttgataatttgaaggatcaagaatagtgcacaaaaaacatctccgctggggaagtttcccaaaccagctaatttaggaggta |
46772732 |
T |
 |
| Q |
230 |
cagtgtctctgctt |
243 |
Q |
| |
|
||||| || ||||| |
|
|
| T |
46772731 |
cagtgcctttgctt |
46772718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 46772977 - 46772941
Alignment:
| Q |
1 |
aaattctcaggggcgttatttaatctagagttccttc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46772977 |
aaattctcaggggcgttatttaatctagagttccttc |
46772941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University