View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9928_high_8 (Length: 216)
Name: NF9928_high_8
Description: NF9928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9928_high_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 48372711 - 48372926
Alignment:
| Q |
1 |
aaaatgaaaggtcgcttttttagattggtttgcggatgaaacatgttttagtcacttatgtgattttgatctctgtctttgaaattgttactatccaatn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48372711 |
aaaatgaaaggtcgcttttttagattggtttgcggatgaaacatgttttagtcacttatgtgattttgatctctgtctttgaaattgttactatccaata |
48372810 |
T |
 |
| Q |
101 |
nnnnnnntcaataaactatacacacattaataattgatctctgtctttgagtctatttttgttgtgtttaacattttttccctcctgtagttctgatccg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48372811 |
aaagaaatcaataaactatacacacattaataattgatctctgtctttgagtctatttttgttgtgtttaacattttttccctcctgtagttctgatccg |
48372910 |
T |
 |
| Q |
201 |
ttcagcataaaaactt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
48372911 |
ttcagcataaaaactt |
48372926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University