View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9928_low_4 (Length: 248)
Name: NF9928_low_4
Description: NF9928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9928_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 39300759 - 39300997
Alignment:
| Q |
1 |
tgcttggtagaaagaggtacactgcagatcaatggaagacacctggtctcaataaatgatttaacagtttattggtgattcaagaatattcaattcgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300759 |
tgcttggtagaaagaggtacactgcagatcaatggaagacacctggtctcaataaatgatttaacagtttattggtgattcaagaatattcaattcgatc |
39300858 |
T |
|
| Q |
101 |
ttccttttgttgtgggttatttttgaacaattatatttagactgtcattcattcaaatctcaagtttgaatctttagagtgtcaatgannnnnnnnnatt |
200 |
Q |
| |
|
||| ||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
39300859 |
ttcgttttgttgtggcttatttttgaacaattatatttagagtgtgattcattcaaatctcaagtttgaatctttagagtgtccctga-ttttttttatt |
39300957 |
T |
|
| Q |
201 |
ttgtgtggactaatccatacataattttgttttgcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300958 |
ttgtgtggactaatccatacataattttgttttgcctttg |
39300997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University