View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9928_low_8 (Length: 230)
Name: NF9928_low_8
Description: NF9928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9928_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 11 - 216
Target Start/End: Complemental strand, 36331558 - 36331354
Alignment:
| Q |
11 |
agaacctgtgcaacaattttatgatgttagcatgattaattttacgcgtttttgctgataaaacttaagtgtttttactcgttgtccaaatatcaaactt |
110 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331558 |
agaacctgtgcaacaattttacgatgttagcatgagtaattttacgcgtttttgctgataaaacttaagtgtttttactcgttgtccaaatatcaaactt |
36331459 |
T |
|
| Q |
111 |
aagtgtttttactcatcgagatttcagatgaaagtgtgtatattaactatataaattaattcannnnnnncaaattattactattatcgactgccagggt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36331458 |
aagtgtttttactcatcgagatttcagatgaaagtgtgtatattaactatataaattaattca-ttttttcaaattattactattatcgactgccagggt |
36331360 |
T |
|
| Q |
211 |
taatgc |
216 |
Q |
| |
|
|||||| |
|
|
| T |
36331359 |
taatgc |
36331354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University