View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9929_low_1 (Length: 217)

Name: NF9929_low_1
Description: NF9929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9929_low_1
NF9929_low_1
[»] chr3 (1 HSPs)
chr3 (43-130)||(16151951-16152038)


Alignment Details
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 43 - 130
Target Start/End: Complemental strand, 16152038 - 16151951
Alignment:
43 aataagtgtattatattttggtgatacattattcataacctatgtttttggaatatggaattccacaccatactactgaaagcttggc 130  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||||||||||||    
16152038 aataagtgtattattttttggtgatacattattcataacctatgtttttggaatatgggatttcacaccttactactgaaagcttggc 16151951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University