View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9929_low_1 (Length: 217)
Name: NF9929_low_1
Description: NF9929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9929_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 43 - 130
Target Start/End: Complemental strand, 16152038 - 16151951
Alignment:
| Q |
43 |
aataagtgtattatattttggtgatacattattcataacctatgtttttggaatatggaattccacaccatactactgaaagcttggc |
130 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
16152038 |
aataagtgtattattttttggtgatacattattcataacctatgtttttggaatatgggatttcacaccttactactgaaagcttggc |
16151951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University