View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9930_high_14 (Length: 287)
Name: NF9930_high_14
Description: NF9930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9930_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 78 - 277
Target Start/End: Complemental strand, 42950433 - 42950233
Alignment:
| Q |
78 |
aaatatcctatggttacagaggagtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaaga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950433 |
aaatatcctatggttacagaggagtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaaga |
42950334 |
T |
 |
| Q |
178 |
taacagtgttcgaatgctaggaaaagggaagataacggtgttatgtttcacatgcc-actaccttcatcttcttcaacagtatcaaacaaaatatccttt |
276 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950333 |
taacagtgttcgaatgctaggaaaatggaagataacggtgttatgtttcacatgccttataccttcatcttcttcaacagtatcaaacaaaatatccttt |
42950234 |
T |
 |
| Q |
277 |
g |
277 |
Q |
| |
|
| |
|
|
| T |
42950233 |
g |
42950233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 42950464 - 42950432
Alignment:
| Q |
16 |
taggggacaaagggtacagaatgcagaaccgaa |
48 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
42950464 |
taggggacaaagggtacagaatgtagaaccgaa |
42950432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 220 - 270
Target Start/End: Complemental strand, 2852033 - 2851983
Alignment:
| Q |
220 |
atgtttcacatgccactaccttcatcttcttcaacagtatcaaacaaaata |
270 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2852033 |
atgtttcacatgccactaccttcatcttcgtcaacaatatcaaacaaaata |
2851983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 220 - 270
Target Start/End: Complemental strand, 2904065 - 2904015
Alignment:
| Q |
220 |
atgtttcacatgccactaccttcatcttcttcaacagtatcaaacaaaata |
270 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2904065 |
atgtttcacatgccactaccttcatcttcgtcaacaatatcaaacaaaata |
2904015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University